Back to search resultsSummaryRMgm-212
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 3 |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 19428669 |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | M. Tufet-Bayona, C.J. Janse, R.E. Sinden, B. Franke-Fayard |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1101400 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0501600 | ||||||||||||||||||||||||
Gene product | rhoptry-associated protein 2 | ||||||||||||||||||||||||
Gene product: Alternative name | RAP2/3; rhoptry-associated protein 2/3 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | Asp718/EcoRI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | In P. falciparum a low-molecular-weight protein complex, consisting of three non-covalently linked members, RAP1, RAP2 and RAP3 localises to the rhoptries of merozoites. RAP2 and RAP3 are encoded by adjacent genes (PFE0080c; PFE0075c), organised in a head to tail fashion on chromosome 5. Both rap2 and rap3 show a high homology with the single copy, syntenic gene, rap2/3 of P. berghei. The RAP proteins are implicated in the invasion of the erythrocyte by the merozoite. Gen Bank accession number P. berghei rap2/3: XM 669159.1 See RMgm-209 for a mutant expressing a GFP-tagged RAP2/3 protein. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |