Summary

RMgm-211
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1101400; Gene model (P.falciparum): PF3D7_0501500; Gene product: rhoptry-associated protein 3 (RAP2/3; rhoptry-associated protein 2/3)
PhenotypeNo phenotype has been described
Last modified: 12 May 2009, 11:55
  *RMgm-211
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19428669
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherM. Tufet-Bayona, C.J. Janse, R.E. Sinden, B. Franke-Fayard
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center (LUMC)
CityLeiden
CountryThe Netherlands

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1101400
Gene Model P. falciparum ortholog PF3D7_0501500
Gene productrhoptry-associated protein 3
Gene product: Alternative nameRAP2/3; rhoptry-associated protein 2/3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
TTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTT
TTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGA
AAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTA
AATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTG
AAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCT
CTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCAT
AGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTT
CCTTCAATTTCGATTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTATGC
TTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTGTG
CTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTAAA
TTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAAAT
CAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTATGC
ATAAAAATTAAAGTGCCCTTTATTAACTAGAACTAGTCGTAATTATTTATATTTCTATGT
TATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATA
ATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACA
AAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAAT
ATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAAT
TTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCA
GAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAG
ATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTAT
GGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAA
TTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAG
TCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGT
CTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAA
ACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGA
TTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGA
GAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATGCTAGCGGAGGAGGTGG
ATCTGGTGGAGGTGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAAGTGGGATCAGAA
GGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGTGTTCCTAT
TGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAG
ATTTCAAAAGGGATCCGCCACACTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAG
ATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACAT
GTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAA
TTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGA
CGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTT
TGAAGATATTGGTGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCTACCTCAAACAAA
CCAATTGCTGGGTTTGTACACCATCATCAGAAATAAGAATACAACTAGACCTGATTTCAT
TTTCTACTCCGATAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAACCATCTACCTGT
GCAAAAGCAAATTGTGGAAACTGACACCAACGAAAACTTCGAAGGTGTCTCATTCATGGG
TAAAATCTGTGGTGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCAAGGATTAAGAGA
CTGTTGTAGGTCTGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGAGGAGACTGCTTT
ACCAAAGTTATTCTACGAAAAATTACCAGAGGATATATCTGAAAGGTATGTCTTCCTATT
AGACCCAATGCTGGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGTCTTGATTAAGAG
AGGTGTTAAGCCAGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAAGGAAGGGATTGA
AAAATACCATGCCGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCTCGACAGAGGTCT
AGATGAAAACAAGTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAGATACTACTGTGT
TTAACTCGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTG
TAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCT
AAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGC
TAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAA
ATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTAT
TATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTG
ATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAA
AAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACGTACCCTCGAGG
TTTTTTTGATGCACTTGATAGTACTTTAAATTGTTACACCAATAAATATATGAATTTACC
TGGTGATATATATTTGGATACTAAGATGGTCGGCGCATAAGTTTTTTTATCAATAAATGA
GCTATTAAGTTTTTATTTTTTATGTAATAGTTATATATATATATTATGTTTTTTTATTGA
TGATATGTTATTTAATCTATTAGAAAAATATTTAGATAAAATCGTGAAATATATATTATA
AACATGTTTAATAATAAACTATAGTATGTCTAATATTTATGATTTGTTTCAAATATACAC
ACGAATTGTTAAACATGAGAAAATAAGTAAATTTGATTGGATATAATGTTTATTCCCTTT
ATTTTATATCCATATTTTTAGTTGAAAACTTTTTTATATATTTAAAGGTTATACTGACAA
ATGGTAATATATTTTCCCCTTGCATCATTTGATAACGAATTCCTGCAGCCCGGGGGATCC
ACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTA
TTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCA
ACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCG
CACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAG
CGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAG
CGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTT
TCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCA
CCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATA
GACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCA
AACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCC
GATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAA
CAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCT
ATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGA
TAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCC
CTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTG
AAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTC
AACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACT
TTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTC
GGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAG
CATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGAT
AACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT
TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAA
GCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGC
AAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATG
GAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATT
GCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCA
GATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGAT
GAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCA
GACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGG
ATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCG
TTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTT
CTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATA
CCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCA
CCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAG
TCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGC
TGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGA
TACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGG
TATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAAC
GCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTG
TGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGG
TTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCT
GTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACC
GAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTC
CCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCG
GGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTA
CACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACA
GGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAA
AAGCTGGTACCCATACACAGTGCAAAGATATAAAAAATATATAATTTTTTGAAATAGACA
GATTTATTTGTATAATTTTATAATTATTTATAAAATTTAAAATATAAAATCGATGTTTAA
GAGTTATAATGTTAAATAATAGCATATGATGCATATTCATTTTTATACATGTGTATATTG
ATAGTAAAAGTCTCTAAATAAAAAATATTTTGTTATATATTCTTCAAAAAAATATTATAA
TTGATATTTTAATTTTTTCATTATGAATTAGTAATTTTTTTTAATTTTATTTGTATTTTA
ATAAAATATTTATAGAAGATTTATTTTTGTATGTTCATGATATTAAAAAATATTTAGTTT
GTAAAATTTTACAAAGTTGGAGACACGATTTCTTGAAAACAATTAGTTATTATTACTTTA
TTATTTTATATATATTTTTTTATTTACACCTCATATATTAATTGCACCAATTATATTTTT
ATATAAAACAAAAGTGAAGGCAAAATGTATTTTTTCGTTTCCCTTTTTCTATGTCATGA
Restriction sites to linearize plasmid Asp718/EcoRI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationIn P. falciparum a low-molecular-weight protein complex, consisting of three non-covalently linked members, RAP1, RAP2 and RAP3 localises to the rhoptries of merozoites. RAP2 and RAP3 are encoded by adjacent genes (PFE0080c; PFE0075c), organised in a head to tail fashion on chromosome 5. Both rap2 and rap3 show a high homology with the single copy, syntenic gene, rap2/3 of P. berghei. The RAP proteins are implicated in the invasion of the erythrocyte by the merozoite.

Gen Bank accession number P. berghei rap2/3: XM 669159.1

See RMgm-209 for a mutant expressing a GFP-tagged RAP2/3 protein.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCCGGTACCGTACATTTATGCATACACAGTGC
Additional information primer 1L4046 (KpnI); 5' Designed on consensus sequences of 5’upstream region of P chabaudi (PC000289.00.0) and P yoelli (PY03918)
Sequence Primer 2GCCAAGCTTCATGACATAGAAAAAGGGAAACG
Additional information primer 2L4047 (HindIII); 5' Designed on consensus sequences of 5’upstream region of P chabaudi (PC000289.00.0) and P yoelli (PY03918)
Sequence Primer 3GCCCTCGAGGTTTTTTTGATGCACTTGATAG
Additional information primer 3L3991 (XhoI); 3'
Sequence Primer 4GCCGAATTCGTTATCAAATGATGCAAGGGG
Additional information primer 4L3992 (EcoRI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6