Summary

RMgm-18
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0524800; Gene model (P.falciparum): Not available; Gene product: early transcribed membrane protein small exported protein (SEP1; ETRAMP; Pbsep1)
PhenotypeNo phenotype has been described
Last modified: 28 August 2011, 22:27
  *RMgm-18
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-18
Principal name∆etramp11.1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of SEP1 (early transcribed membrane protein, ETRAMP; ETRAMP11.1).

Protein (function)
In P. berghei, this gene belongs to a family of three related genes (encoding so-called SEP proteins; SEP1-3), located in the subtelomeric regions of chromosomes 5 (Birago et al., Mol. Biochem. Parasitol. (2003) 126, 209-18). The SEP proteins show homology to members of the ETRAMP family of proteins of P. falciparum but the orthologous relationship of the different members is unclear (ortholog of etramp11.1, PF11_0039?).
The sep1 gene encodes encodes an integral membrane protein that is expressed during the entire erythrocytic cycle and is present in the parasitophorous vacuole membrane. The protein contains a predicted signal peptide at the NH(2)-terminus, an internal hydrophobic region and a polymorphic, low-complexity region at the carboxy-terminus (Birago et al., Mol. Biochem. Parasitol. (2003) 126, 209-18).

Phenotype
The lack of expression of SEP1 does not result in a clear phenotype. In this study no in depht analysis of the phenotype of the different life cycle stages has been performed. Numbers of oocysts and salivary gland sporozoites in Anopheles stephensi are normal. The mutant could 'easily be transmitted' by A. stephensi. See also the mutant parasite line RMgm-16. In this mutant the same gene has been dirupted without a clear phenotype.

Other mutants
An independent mutant lacking expression of SEP1 has been generated (see RMgm-16)
The two other sep genes, sep2 (PB106367.00.0; early transcribed membrane protein, ETRAMP; sep-bis) and sep3 (PB401867.00.0; sep-ter) have been targeted for gene disruption (pers. comm. M. Ponzi, T. Pace). See RMgm-64 (sep2) and RMgm-65 (sep3).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0524800
Gene Model P. falciparum ortholog Not available
Gene productearly transcribed membrane protein small exported protein
Gene product: Alternative nameSEP1; ETRAMP; Pbsep1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCTTTATATTTTCTTATAGTGCAGG
Additional information primer 1AE15a (ApaI); 5'
Sequence Primer 2CCAAGCTTGGGAATTAATGTAATTATAAGAG
Additional information primer 2AE15b (HindIII); 5'
Sequence Primer 3TGAATTCATCTAGCACAAAACCAGTACCAG
Additional information primer 3AE15c (EcoRI); 3'
Sequence Primer 4GGGGATCCACACACATCACGGCACTATTTAC
Additional information primer 4AE15d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6