Summary

RMgm-168
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0408200; Gene model (P.falciparum): PF3D7_0310100; Gene product: calcium-dependent protein kinase 3 (CDPK3)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_0711900; Gene product: heat shock protein 70 (HSP70)
Insertion locus: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 21 December 2011, 14:40
  *RMgm-168
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16430692
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherT. Ishino; M. Yuda
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-168
Principal namecdpk3(-)/gfp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. These ookinetes have a (light microscope) morphology that is comparable to wild type ookinetes. Ookinetes show a strong reduction (99%) in the formation of oocysts in A. stephensi mosquitoes. Ookinetes fail to invade midgut epithelial cells. Ookinetes are severely impaired in the ability to migrate in vitro through a gel structure (Matrigel; see 'Additional information'). Ookinetes were able to move on the gel surface.
OocystOokinetes show a strong reduction (99%) in the formation of oocysts in A. stephensi mosquitoes.
The few oocysts that are produced, form normal numbers of sporozoites that are infectious to the mammalian host as determined by intravenous inoculation of sporozoites in rats.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of CDPK3 (calcium-dependent protein kinase 3) and expresses GFP under the constitutive HSP70 promoter.
This mutant has been generated by a genetic cross between mutant RMgm-165 lacking expression of CDPK3 and mutant RMgm-166 that expresses GFP (see 'Additional information: genetic modification).

Protein (function)
CDPK3 belongs to an expanded family of Ca2+ dependent protein kinases (CDPKs). CDPKs combine an amino-terminal serine/threonine kinase domain and a carboxy-terminal calmodulin-like domain, composed of four EF hands, in the same molecule. In plants, CDPKs translate Ca2+ signals generated by external stimuli into cellular responses, thereby regulating cell division and differentiation, the development of tolerance to stress stimuli and the specific defense responses to pathogens.

Phenotype
The phenotype analyses indicate a role of CDPK3 in the transformation of the mature ookinete into the oocyst. Specifically, ookinetes fail to bind and traverse the cell of the midgut wall.
This mutant has been generated by a genetic cross between mutant RMgm-165 lacking expression of CDPK3 and mutant RMgm-166 that expresses GFP (see 'Additional information: genetic modification). See also RMgm-165 for a description of the phenotype of the mutant lacking expression of CDPK3. Electron microscopic analyses of mutant RMgm-165 demonstrated that the disruptant ookinetes could not access midgut epithelial cells by traversing the layer covering the cell surface.
The GFP-fluorescent ookinetes have been used to analyse the in vitro motility behavior of ookinetes. Ookinetes are severely impaired in the ability to migrate in vitro through a gel structure (Matrigel; see 'Additional information'). Ookinetes were able to move on the gel surface.

Additional information
The GFP-fluorescent ookinetes have been used to analyse the in vitro motility behavior of ookinetes. Cultured GFP-expressing wild-type or mutant ookinetes were inoculated to the top of a layer of gelled basement membrane matrix (Matrigel) in a 24 well plate and were allowed to migrate. After 8 h the number of ookinetes that entered the Matrigel and the depth they reached were measured by optical and confocal microscopy. Soon after inoculation, almost all wild-type ookinetes entered the gel and started moving towards the bottom of the layer. In contrast most mutant ookinetes remained on the gel surface. The small proportion of disruptant ookinetes (6%) that succeeded in entering the gel remained near the surface. These results indicated that mutant ookinetes are impaired in the ability to migrate through a gel structure, which might explain the failure to cross the layer covering the surface of the midgut epithelium.
Real time images of mutant ookinetes showed that they are able to move on the gel surface. This indicates that without CDPK3 ookinetes have a surface motility that is distinguishable from their ability to traverse a gel.

An independent mutant lacking expression of CDPK3, RMgm-154, has been generated which show a comparable defect in ookinete to oocyst transition. However, instead of the specific defect in traversal of the layer covering the epithelial cells, a more general defect in motility of the ookinetes was observed, suggesting a role for CDPK3 in regulating productive gliding motility of ookinetes.

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation. After transfection with a KO vector a weak PCR signal diagnostic for integration was observed, indicating that integration does transiently occur but parasites with a disrupted locus do not persist. Cloning will be required to validate this interpretation for this gene.

Other mutants
RMgm-154: An independent mutant lacking expression of CDPK3
RMgm-165: A mutant lacking expression of CDPK3 which has been used to genereate muatnt RMgm-168 by genetic crossing with mutant RMgm-166,  that expresses GFP
RMgm-12: A mutant lacking expression CDPK4


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0408200
Gene Model P. falciparum ortholog PF3D7_0310100
Gene productcalcium-dependent protein kinase 3
Gene product: Alternative nameCDPK3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThis mutant has been generated by a genetic cross between mutant RMgm-165 lacking expression of CDPK3 and mutant RMgm-166 that expresses GFP.
Mosquitoes were fed on a mouse infected with RMgm-166 parasites and RMgm-165 parasites in the ratio of 1:9. Mosquitoes were fed on this mouse, and sporozoites were collected from mosquito salivary glands and injected into a rat intravenously. When parasitaemia reached 1%, erythrocytes infected by GFP-expressing parasites were sorted by an Epics Altra (Beckman Coulter, Fullerton, CA), and injected into a fresh rat. Finally, cdpk3(-)-GFP-expressing parasites were separated by limiting dilution.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAAGAGCTCCTTCTTAAATTTGTCCACTTGCC
Additional information primer 1SacI; 5' targeting region
Sequence Primer 2AAAGGATCCGCAGCTAAACCAAAGTCGATG
Additional information primer 2BamHI; 5' targeting region
Sequence Primer 3CCGCTCGAGGAATAATATCTCAGAAGAGGCTAAG
Additional information primer 3XhoI; 3' targeting region
Sequence Primer 4GCCGGTACCGCCTCATTAAAACAAGAGTCTACAAC
Additional information primer 4KpnI; 3' targeting region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThis mutant has been generated by a genetic cross between mutant RMgm-165 lacking expression of CDPK3 and mutant RMgm-166 that expresses GFP.
Mosquitoes were fed on a mouse infected with RMgm-166 parasites and RMgm-165 parasites in the ratio of 1:9. Mosquitoes were fed on this mouse, and sporozoites were collected from mosquito salivary glands and injected into a rat intravenously. When parasitaemia reached 1%, erythrocytes infected by GFP-expressing parasites were sorted by an Epics Altra (Beckman Coulter, Fullerton, CA), and injected into a fresh rat. Finally, cdpk3(-)-GFP-expressing parasites were separated by limiting dilution.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0711900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4