Summary

RMgm-165
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0408200; Gene model (P.falciparum): PF3D7_0310100; Gene product: calcium-dependent protein kinase 3 (CDPK3)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 21 December 2011, 14:36
  *RMgm-165
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 16430692
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherT. Ishino; M. Yuda
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-165
Principal namecdpk3(-)1; cdpk3(-)2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. These ookinetes have a (light microscope) morphology that is comparable to wild type ookinetes. Ookinetes show a strong reduction (99%) in the formation of oocysts in A. stephensi mosquitoes. Ookinetes fail to invade midgut epithelial cells.
Electron microscopic analyses demonstrated that the disruptant ookinetes could not access midgut epithelial cells by traversing the layer covering the cell surface.
OocystOokinetes show a strong reduction (99%) in the formation of oocysts in A. stephensi mosquitoes.
The few oocysts that are produced, form normal numbers of sporozoites that are infectious to the mammalian host as determined by intravenous inoculation of sporozoites in rats.
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of CDPK3 (calcium-dependent protein kinase 3).

Protein (function)
CDPK3 belongs to an expanded family of Ca2+ dependent protein kinases (CDPKs). CDPKs combine an amino-terminal serine/threonine kinase domain and a carboxy-terminal calmodulin-like domain, composed of four EF hands, in the same molecule. In plants, CDPKs translate Ca2+ signals generated by external stimuli into cellular responses, thereby regulating cell division and differentiation, the development of tolerance to stress stimuli and the specific defense responses to pathogens.

Phenotype
The phenotype analyses indicate a role of CDPK3 in the transformation of the mature ookinete into the oocyst. Specifically, ookinetes fail to bind and traverse the cell of the midgut wall. Electron microscopic analyses demonstrated that the disruptant ookinetes could not access midgut epithelial cells by traversing the layer covering the cell surface. See also RMgm-168 for a further analysis of motility and traversal behaviour of ookinetes lacking expression of CDPK3.
The production of infectious sporozoites by the few oocysts that were formed, indicates that the role of CDPK3 is restricted to the ookinete stage.

Additional information
An independent mutant lacking expression of CDPK3, RMgm-154, has been generated which show a comparable defect in ookinete to oocyst transition. However, instead of the specific defect in traversal of the layer covering the epithelial cells, a more general defect in  motility of the ookinetes was observed, suggesting a role for CDPK3 in regulating productive gliding motility of ookinetes.

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation. After transfection with a KO vector a weak PCR signal diagnostic for integration was observed, indicating that integration does transiently occur but parasites with a disrupted locus do not persist. Cloning will be required to validate this interpretation for this gene.

Other mutants
RMgm-154: An independent mutant lacking expression of CDPK3
RMgm-168: A mutant lacking expression of CDPK3 and expressing GFP under control of the hsp70 promoter. This mutant has been generated by crossing mutant RMgm-165 lacking expression of CDPK3 with mutant RMgm-166 that expresses GFP
RMgm-12: A mutant lacking expression CDPK4


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0408200
Gene Model P. falciparum ortholog PF3D7_0310100
Gene productcalcium-dependent protein kinase 3
Gene product: Alternative nameCDPK3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAAGAGCTCCTTCTTAAATTTGTCCACTTGCC
Additional information primer 1SacI; 5' targeting region
Sequence Primer 2AAAGGATCCGCAGCTAAACCAAAGTCGATG
Additional information primer 2BamHI; 5' targeting region
Sequence Primer 3CCGCTCGAGGAATAATATCTCAGAAGAGGCTAAG
Additional information primer 3XhoI; 3' targeting region
Sequence Primer 4GCCGGTACCGCCTCATTAAAACAAGAGTCTACAAC
Additional information primer 4KpnI; 3' targeting region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6