Summary

RMgm-1364
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1328000; Gene model (P.falciparum): PF3D7_1464600; Gene product: serine/threonine protein phosphatase UIS2, putative (UIS2)
PhenotypeNo phenotype has been described
Last modified: 5 April 2016, 10:28
  *RMgm-1364
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26735921
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherZhang M; Nussenzweig V
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUS

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1328000
Gene Model P. falciparum ortholog PF3D7_1464600
Gene productserine/threonine protein phosphatase UIS2, putative
Gene product: Alternative nameUIS2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe unsuccessful attempts to disrupt this gene indicate an essential function during asexual blood stage growth/multiplication
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gctgaaaaatatgaagataaagaattaaac
Additional information primer 1gattttgaaacgatagaaagctcatcg
Sequence Primer 2ggctcccaatatgcatatatcaaatc
Additional information primer 2tgcgtgcttgcgctctgattacc
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6