RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1296
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0711400; Gene model (P.falciparum): PF3D7_0819400; Gene product: perforin-like protein 4 (PPLP4)
Phenotype Oocyst;
Last modified: 12 June 2015, 20:50
  *RMgm-1296
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-1296
Principal namePPLP4(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot different from wild type
OocystNo oocyst formation
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PPLP4 (perforin-like protein 4)

Protein (function)
PPLP4 encodes one of the five PPLP genes (PPLP1–PPLP5) identified in the P. berghei genome that contains a membrane attack complex/perforin (MACPF) domain (see also the link PPLP for other mutants with disrupted or tagged pplp genes)

Phenotype
The successful knock-out of pplp4 indicates it has no essential role during blood stage development/multiplication. The mutant produced normal numbers of ookinetes. No oocysts were produced.

Additional information
Targeting PPLP4 did not affect ookinete conversion rates and morphologies of ookinetes but resulted in the complete loss of infectivity to mosquitoes . Parasites were generated that constitutively expressed GFP from these disruptant populations and midgut invasion by ookinetes in vivo was assessed at 24 h after an infective blood meal by mosquitoes. A small number of ookinetes were observed in the midgut. However, almost all these ookinetes still displayed elongated shapes (99.5 ± 1.4%), whereas in wild-type parasites, the majority of ookinetes associated with the midgut had already started to transform into early oocysts. This means that the ookinetes associated with the midguts observed in the parasites may not have arrived at the basal lamina but may have rather attached to the apical side of the epithelial cells, as we reported in PPLP3/MAOP disruptants. Three PPLPs, PPLP3–PPLP5, were detected in ookinete micronemes during a proteomic study, and PPLP3 and PPLP5 are essential for ookinete infection of the midgut. The present results demonstrated that all three ookinete PPLP genes were AP2-O targets and are essential for infection of the midgut. This is in clear contrast with the redundancy of other target genes in this category, raising the possibility that these PPLPs assemble into a protein complex and form MAC on the plasma membrane of a target cell, as do human complement proteins C6–C9, which all contain a MACPF domain.

Other mutants

See the link PPLP for other mutants with disrupted or tagged pplp genes


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0711400
Gene Model P. falciparum ortholog PF3D7_0819400
Gene productperforin-like protein 4
Gene product: Alternative namePPLP4
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TATTCACCCCAACTGTCTTATCAAGAC
Additional information primer 1CTCATCTACAAGCATCgtcgacTAAGATATGCACTTATTTTGGG
Sequence Primer 2CCTTCAATTTCGgatccactagGGAGGAAATGAGCACAAATTTG
Additional information primer 2TTAAAAAATGAAAGAGAAATCGCCCCG
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6