RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1266
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1112400; Gene model (P.falciparum): PF3D7_0512700; Gene product: orotate phosphoribosyltransferase (OPRT)
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 9 June 2015, 18:43
  *RMgm-1266
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26042734
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherSrivastava A; Waters AP
Name Group/DepartmentWellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation
Name InstituteUniversity of Glasgow
CityGlasgow
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1266
Principal nameG717cl3
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageReduced growth/multiplication of asexual blood stages
Gametocyte/GameteReduced gametocyte production
Fertilization and ookineteStrongly reduced ookinete formation
OocystStrongly reduced oocyst formation
SporozoiteNo sporozoite formation
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Orotate phosphoribosyltransferase (OPRTase) and expresses GFP under the constitutive eef1a promoter.

Protein (function)
Orotate phosphoribosyltransferase (OPRTase) is the fifth enzyme in the de novo pyrimidine-synthesis pathway in the parasite, which lacks salvage pathways.
OPRTase catalyses the conversion of orotate and 5-phospho-d-ribosyl 1-pyrophosphate (PRPP) into orotidine 5′-monophosphate (OMP).

Phenotype
Phenotype analyses indicate that OPRTase is not essential for blood stage development, both for asexual stages as for gametocytes.

(Strongly) reduced gametocyte-, ookinete- and oocyst production. No formation of sporozoites.

Additional information
The oprt-  mutant parasites grew slowly (asexual cycle prolonged by approximately 4–5 hours compared to wt), were rapidly outgrown in a competition growth assay with wt parasites and  seem to invade very young reticulocytes.
Furthermore, the mutant was found to generate, on average, significantly fewer merozoites than wt parasites (17.5 ± 1.8) per schizont (counted after completion of asexual cycle)  and the asexual parasites also took longer to mature to schizonts. The mutant showed altered lethality in the C57/B6 mouse model as the mice infected with the mutants did not manifest the symptoms of experimental cerebral malaria (ECM) but died between days 14–20 as a result of severe anaemia and hyperparasitemia. Gametocytemia was significantly reduced but no change was seen inmale- female ratio. Exflagellation (the production of mature male gametes) was found to be severely affected. Consistent with the defects in male gametogenesis, very few ookinetes were formed in in vitro cultures.  Infectivity to the mosquito was significantly reduced  as seen by observing oocysts in infected mosquito midguts and salivary gland sporozoites and infection to naïve mice was found to be completely blocked.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1112400
Gene Model P. falciparum ortholog PF3D7_0512700
Gene productorotate phosphoribosyltransferase
Gene product: Alternative nameOPRT
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GU2190 CCTTTTCCTTTTGTTTTATCCATCCATTTA
Additional information primer 1GU2191 AATCTCAAATTGTGAAATAAACAATAAAAAATTTTGTC
Sequence Primer 2GU2192 CTGAGTTCTGTATTTACTTTCATAAGTTTTTAAACG
Additional information primer 2GU2193 CCCACATAAGTAAATATACATACACATATTATTATGC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4