RMgmDB - Rodent Malaria genetically modified Parasites
Back to search resultsSummaryRMgm-1158
|
||||||||||
Last modified: 20 March 2016, 14:11
*RMgm-1158| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26991313 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 676m1cl1 (RMgm-29) |
| Other information parent line | 676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | Rijpma SR, Janse CJ, Franke-Fayard BM |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1237800 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0523000 | ||||||||||||||||||||||||
| Gene product | multidrug resistance protein 1 | ABC transporter B family member 1 | ||||||||||||||||||||||||
| Gene product: Alternative name | MDR1; ABCB1; Pgh1 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | Three unsuccessful transfection experiments using DNA construct pL1617 (exp. 1624, 1656, 1724). The unsuccessful attempts to delete the gene indicate an essential role during blood stage growth/multiplication. In different Plasmodium parasites 14-16 ABC-transporter genes have been identified (16 in P. falciparum, 14 in P. berghei). Based on phylogenetic analysis of the conserved nucleotide-binding domains, seven of these are recognized as members of the B family of ABC transporters (both in P. falciparum and in P. berghei). This includes MDR1, which has been most intensively studied for its involvement in antimalarial drug resistance. Amplifications and polymorphisms of PfMDR1 are associated with decreased sensitivity towards multiple antimalarial drugs, including chloroquine and artemisinin. Its primary localization on the membrane of the digestive vacuole may indicate involvement in drug accumulation, where several antimalarial compounds interfere with polymerization of reactive free heme released upon hemoglobin digestion. Pfmdr1 polymorphisms have been shown to reduce drug accumulation resulting in antimalarial resistance. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||