Mutant/mutation
The mutant contains a disrupted sera1 locus.
This locus has been disrupted by  the CRISPR/Cas9 genome editing system through  introduction of a double strand break (by Cas9 and a targeting single guide RNA; sgRNA), followed by repair through homologous recombination (see 'Additional information')

Protein (function)
Plasmodium species possesses SERAs of two major groups, specified as 'cysteine-type SERAs' and 'serine-type SERAs'. The genomes of different Plasmodium species contain different numbers of SERA genes. P. falciparum possesses nine SERA protease genes whereas the P. berghei and P. yoelii genome contains five. P. falciparum possesses six “serine-type” (SERA1 to SERA5 and SERA9) and three “cysteine-type” (SERA6 to SERA8) SERAs. In P. falciparum mutants have been generated lacking expression of SERA1, 2, 3, 4 , 7, 8 and 9 without a distinct phenotype in the blood stages (MvCoubrie J.E. et al,  2007, Infection and Immunity, 75:5565-74). SERA genes of P. berghei and P. yoelii are arranged in a tandem cluster that contains two serine-type SERAs (PbSERA1, -2) and three cysteine-type SERAs (PbSERA3, -4 and -5). See also mutants RMgm-862 (knock-out of P. yoelii sera1), RMgm-864 (tagging of of P. yoelii sera1).

Phenotype
The phenotype has not been analysed in detail (in reference PMID 24987097). This mutant has been generated to demostrate gene deletion by the CRISPR/Cas9 genome editing system (see 'Additional information')

In reference PMID 29684399 the authors state: 'To confirm that sera1 is not essential for the parasite, we first disrupted the sera1 gene in the 17XNL parasite using CRISPR/Cas9 methods, and obtained two parasite knockout clones (Δsera1c1 and Δsera1c2) with deletion of the whole coding region. Both Δsera1c1 and Δsera1c2 parasite clones displayed normal progression comparable with wildtype parasite in the life cycle, including asexual and sexual gametocytes stages in mice, mosquito stages, and mouse infectivity (Fig. S1C to G), suggesting functional redundancy of the sera1 gene in the life cycle of P. yoelii.

See also mutants RMgm-862 (knock-out of P. yoelii sera1), RMgm-864 (tagging of of P. yoelii sera1).

Additional information

The CRISPR/Cas9 genome editing system has been used to delete sera1.

The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats and Cas9 endonuclease-mediated genome editing) system The CRISPR/Cas9 system was originated from a prokaryotic RNA programmable nuclease that can introduce a double-strand break (DSB) at a specific site on a chromosome through heterologous expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA).
Target-specific DSBs introduced by the CRISPR/Cas9 system can be repaired by homologous recombination if a donor template is provided. The CRISPR/Cas9 system has been shown to be highly efficient in other organisms for generating gene knock-in (KI), KO, or allelic replacements.

CRISPR/Cas9-mediated genome editing requires expression of two components: Cas9 nuclease and a targeting single guide RNA (sgRNA), which form a complex to induce a double-strand break (DSB) at the targeted site.

To reduce the size of the plasmid construct and to overcome the problem of limited selectable markers available for P. yoelii,  an expression plasmid was constructed that contains the human dihydrofolate reductase (hdhfr)-2A peptide-gfp genes under the P. berghei eef1a (Pbeef1a) promoter and showed bicistronic expression of both genes after introduction into the P. yoelii 17XNL strain.
The viral “ribosome skip” 2A peptide has been shown to coordinate coexpression of two individual genes under a single promoter in P. falciparum

Because Cas9 is a nuclease functioning within the nucleus, two nuclear localization signals (NLSs) were attached to the 5' and 3' of the Cas9 gene to direct the protein to the nucleus.

In mammalian systems, sgRNA is synthesized by RNA polymerase III, and transcription is driven by a U6 small nuclear RNA (snRNA) promoter. By searching the P. yoelii genome database,  a U6 snRNA homolog was identified and  a 350-base-pair (bp) segment upstream of the transcriptional start site of U6 snRNA was cloned to function as a promoter.

A Cas9-sgRNA plasmid was constructed containing both the hdhfr-2A-SpCas9 and PyU6-sgRNA cassettes with cloning sites for the insertion of donor template sequences (for homologous recombination at target sequences in the genome).

Next the plasmid pYC-Pysera1 was constructed containing a 46-bp tag DNA (for PCR primers) flanked by two homologous regions of Pysera1 (0.7 kb of the 5'-flanking region and 0.8 kb of the 3'-flanking region). see Figure below

FIG.: CRISPR/Cas9-mediated deletion of P. yoelii sera1 gene. Schematic construct for disrupting the Pysera1 gene. The plasmid contains Cas9 and sgRNA expression cassettes and donor template for HR repair after a double-strand break (DSB) at the 3' end of the Pysera1 exon 2 (red thunderbolt). The DNA inserted (In) between the left and right arms was added to detect donor integration in the design of the PCR primers. Exons 1 to 4 are indicated by the yellow boxes. TS (blue box) indicates the sgRNA target sequence. The positions and directions of primers p10 to p21 are indicated by the small black arrows.

Considering potential variation in target site accessibility by the Cas9/sgRNA complex,  two sgRNAs were designed to target the 3'end of the Pysera1 exon 2, generating plasmids pYC-sera1-sgRNA1 and pYC-sera1-sgRNA2 (see below).

One day after electroporation of the plasmids into the P. yoelii 17XNL strain, parasites were selected with pyrimethamine (Pyr) supplied in drinking water. Pyr-resistant parasites were observed microscopically 5 to 7 days after electroporation. PCR analysis of genomic DNA from parental strain 17XNL and plasmid-transfected parasites indicated successful integration of left and right homologous arms at specific sites directed by sgRNA1 and sgRNA2, respectively.

To  confirm the general usage of the CRISPR/Cas9 system for gene deletion, the paper describes the sucessful deletion of another two genes (which are not essential for blood stage development): Pysera2 (PY17X_0305600), which encodes another Plasmodium serine protease, and PyPDH/E1a (PY17X_0925800).

Two sgRNA's have been tested :
sgRNA 1: GTACCGGGAAACTCTGATCAAGG (genomic target sequence); GTACCGGGAAACTCTGATCA (sgRNA targetr sequence)
sgRNA 2: GCTAGCGACTGTTTCTTACATGG (genomic target sequence); GCTAGCGACTGTTTCTTACA (sgRNA targetr sequence)

See below for primer sequences used to amplify the targeting regions of sera1

Other mutants
See RMgm-1096 for gene-tagging mutants that have been generated by this CRISPR/Cas9 system
See RMgm-1097 for introducing specific mutations in target genes using the CRISPR/Cas9 system