Summary

RMgm-1052
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1227400; Gene model (P.falciparum): PF3D7_0802800; Gene product: serine/threonine protein phosphatase 2B catalytic subunit A (CNA)
PhenotypeNo phenotype has been described
Last modified: 18 July 2014, 11:00
  *RMgm-1052
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification ≥ 5
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25011111
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherDS Guttery, AA Holder, R Tewari
Name Group/DepartmentMalaria Research Group/School of Life Sciences
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1227400
Gene Model P. falciparum ortholog PF3D7_0802800
Gene productserine/threonine protein phosphatase 2B catalytic subunit A
Gene product: Alternative nameCNA
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gene was targetted for deletion/tagging in a systematic functional analysis of the entire P. berghei protein phosphatome, which comprises 30 predicted protein phosphatases (PPs), that exhibit differential and distinct expression patterns during various stages of the life-cycle. Gene disruption analysis of all P. berghei PPs revealed that half of the genes are likely essential for asexual blood stage development; whereas six are essential for sexual development/sporogony in the mosquito.
The parasite utilises a number of signal transduction mechanisms, including reversible protein phosphorylation catalysed by protein kinases (PKs) and phosphatases (PPs). This mechanism of signalling is a conserved, ubiquitous regulatory process for many eukaryotic and prokaryotic cellular pathways.

Sequence analysis of the P. falciparum parasite has revealed approximately 85 putative PK and 27 putative PP catalytic subunits encoded in its genome (the Plasmodium protein phosphatome being one of the smallest of the eukaryotic phyla).
The Plasmodium phosphatome has been classified into 4 major groups: phosphoprotein phosphatases (PPPs), metallo-dependent protein phosphatases (PPMs), protein tyrosine phosphatases (PTPs) and NLI interacting factor-like phosphatases (NIFs), as well as a number of smaller classes.

To define the phosphatome, PPs encoded in the genomes of P. berghei and P. falciparum were identified by similarity to hidden Markov models of known PP catalytic domains. PFam domains were used to define protein sets with similarity to PPP, PTP, PPM, NIF-like and PTP-like A families. There are no predicted PPs with good similarity to the Low-Molecular Weight Phosphatase (LMWP) or CDC25 families. There are also no good matches to models of SSU72 RNA polymerase II CTD phosphatase or Eyes Absent (EYA) phosphatase. Other PFam domains specific to PP catalytic domains are subclasses of the above families. The 5 identified Plasmodium PP families were compared to 4969 PP-like proteins from 44 diverse eukaryotes, to classify them and eliminate PP-like proteins with confirmed non-protein phosphatase functions.

In this study 30 and 29 PPs were identified in the genomes of P. berghei and P. falciparum respectively, encompassing 28 direct orthologues across the 5 PP families described above.
As found with the kinome, the phosphatome is highly conserved with only three proteins without direct orthology between P. falciparum and P. berghei.
On the basis of catalytic domain phylogeny and domain architecture, the Plasmodium PPPtype phosphatases can be further classified into subfamilies, with PPP1 to PPP7 corresponding to the animal PP1-PP7 types. Plasmodium PPPs also include the BSU-like phosphatase PPKL, an EF-hand containing phosphatase (EFPP) and the two SHLPs, none of which is present in the host.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCGAACCTCCCCCATCAAAAGT
Additional information primer 1P0041
Sequence Primer 2GGGGAAGCTTCATCTGGATTTCCACCAACTTC
Additional information primer 2P0042
Sequence Primer 3CCCCGAATTCGAAATTGATAGTATAAATGAAAAGAGACC
Additional information primer 3P0043
Sequence Primer 4GGGGTCTAGACCAACTACATCTCATATTGTTTATGCAGG
Additional information primer 4P0044
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6