Summary

RMgm-101
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1233600; Gene model (P.falciparum): PF3D7_0518800; Gene product: secreted ookinete protein, putative (PSOP13, putative secreted ookinete protein 13)
Phenotype Oocyst; Sporozoite;
Last modified: 19 February 2009, 21:06
  *RMgm-101
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
Name of the mutant parasite
RMgm numberRMgm-101
Principal name∆psop13
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal' numbers of oocysts are produced: 149% of wild type (79-209%). Sporozoite formation (sporulation) is strongly affected in the 'mature' oocysts. Most oocysts appear either immature/enlarged or degenerate/vacuolated.
SporozoiteLow numbers of sporozoites are produced: 8.7% of wild type (1.6-19.6). No tramission to C57BL/6 mice by mosquito bite
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PSOP13 (putative secreted ookinete protein 13)

Protein (function)
Unknown. The protein is detected in a proteome analysis of ookinetes and contains a predicted signal sequence

Phenotype
Phenotype analyses indicate a role during oocyst development and sporozoite formation/production (see also additional information)

Additional information
Crossings of the mutant females with wild type males did not rescue the formation/production of sporozoites. Crossing of the mutant males with wild type females resulted in wild type production of sporozoites that were infectious to C57BL/6 mice.
Crossings between other mutants have shown that wild type males can rescue defects in females that affect ookinete invasion and traversal of the midgut wall at 18-30 hours after fertilisation. The lack of rescue of the ∆psop13 mutant phenotype by crossing of mutant females with wild type males is suggestive of a role of PSOP13 within a few hours after fertilisation.
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1233600
Gene Model P. falciparum ortholog PF3D7_0518800
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP13, putative secreted ookinete protein 13
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPartial gene model. Second gene model involved in the genetic modification: PB300830.00.0
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCAATAACTATCGTTTTTTACAACG
Additional information primer 1AE13a (ApaI); 5'
Sequence Primer 2CCAAGCTTTTGATGCGATACTAAATATTACG
Additional information primer 2AE13b (HindIII); 5'
Sequence Primer 3TGAATTCGTAAGATAAATATTTTGTTGCCT
Additional information primer 3AE13c (EcoRI), 3'
Sequence Primer 4GGGGATCCTTTTATACCATTCCTGAAAGATG
Additional information primer 4AE13d (BamHI), 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6